Journal: Pharmaceutics

Article Title: Myrrh Oil-Based Nanoemulsion Loaded with Curcumin and Insulin: Development, Characterization, and Evaluation of Enhanced Antibacterial and Diabetic Wound-Healing Activity

doi: 10.3390/pharmaceutics18030369

Figure Lengend Snippet: Effect of topical diabetic wound treatments with various preparations on biomarkers of oxidative stress. ( A ): Nuclear factor erythroid 2-related factor-2 (Nrf-2); ( B ): malondialdehyde (MDA); ( C ): reduced glutathione (GSH). ###: Significantly different compared with the normal control group at p < 0.001, #### at p < 0.0001. *: Significantly different compared with DM + B-NEG group at p < 0.05, ** at p < 0.01, *** at p < 0.001, **** at p < 0.0001. $$$$: Significantly different compared with the CUR-G group at p < 0.0001. @: Significantly different compared with INS-G group at p < 0.05, @@ at p < 0.001.

Article Snippet: An enzyme-linked immunosorbent assay (ELISA) kit was used to measure the concentration of nuclear factor erythroid 2-related factor 2 (Nrf-2, BT LAB, Shanghai, China) in skin tissue homogenate following the manufacturer’s procedures.

Techniques: Control

Journal: bioRxiv

Article Title: Alterations of redox and iron metabolism accompany development of HIV latency

doi: 10.1101/549014

Figure Lengend Snippet: (A) Subcellular localization of Nrf2 in CD4 + T-cells infected with HIV-1 or mock infected (3 dpi) as analyzed by biochemical fractionation. (B) Nuclear localization (left) and content (right) of Nrf2 in HIV-1 RNA + and HIV-1 RNA - cells (7 dpi) as measured by combining IF and HIV-1 RNA FISH. Scale bar = 2μm. n= number of cells from 3 donors. (C, D) Time course of the relative (infected vs mock infected) mRNA (C) and protein (D) levels of main targets of Nrf2 during the transition from productive (3-9 dpi) to latent (14 dpi) infection as measured by qPCR and western blot, respectively. TrxR1 and HMOX-1 were probed upon membrane stripping. (E) Comparison of the effect of different HIV-1 mutations on the mean relative (infected vs mock infected) mRNA level of the Nrf2 targets described in panel D. Values shown in panel B were calculated as nuclear corrected total cell fluorescence (as in) and analyzed by two-tailed unpaired t -test. For panels C, E, raw data were first normalized using GAPDH as housekeeping control and then expressed as Log 2 fold mRNA expression in infected vs mock infected cells (calculated using the 2-ΔΔCTmethod . In panel E the average of the six genes listed in Panel C is shown. For both panels data were analyzed by-two way ANOVA followed by Turkey’s post-test for multiple comparisons. ** P <0.01; *** P <0.001; **** P <0.001. Trx= thioredoxin; NQO1= NAD(P)H Quinone Dehydrogenase 1; HMOX-1= Heme Oxygenase 1; G6PD= glucose-6-phosphate dehydrogenase; GCLC= Glutamate—cysteine ligase; TrxR1= thioredoxin reductase 1.

Article Snippet: IF for Nrf2 (mab3925, 1:250; R&D systems, Minneapolis, MN) or PML (sc/966x, 1:500; Santa Cruz Biotechnology, Dallas, TX, USA) for 1-2 hr at RT.

Techniques: Infection, Fractionation, Western Blot, Membrane, Stripping Membranes, Comparison, Fluorescence, Two Tailed Test, Control, Expressing

Journal: Cell Reports Medicine

Article Title: Boosting NAD preferentially blunts Th17 inflammation via arginine biosynthesis and redox control in healthy and psoriasis subjects

doi: 10.1016/j.xcrm.2023.101157

Figure Lengend Snippet:

Article Snippet: pLenti-c-Myc-DDK-NRF2 , Origene Technologies , Cat. RC204140L2.

Techniques: Flow Cytometry, Virus, Recombinant, Staining, Cell Stimulation, CyQUANT Assay, Proliferation Assay, Bicinchoninic Acid Protein Assay, In Vitro, Antioxidant Assay, Detection Assay, GSH Assay, Bioassay, Transcription Factor Assay, Extraction, Enzyme-linked Immunosorbent Assay, Control, Software, Cell Isolation, Transfection

Journal: Free radical biology & medicine

Article Title: NAD(P)H:quinone oxidoreductase 1 activity reduces hypertrophy in 3T3-L1 adipocytes.

doi: 10.1016/j.freeradbiomed.2012.05.047

Figure Lengend Snippet: Fig. 2. Keap1 protein decreases in differentiated adipocytes, while steady-state mRNA expression for Nrf2 and Keap1 increases. 3T3-L1 cells were differentiated as described under Materials and methods and harvested on Days 0, 4, 8, 11, and 14. (A) Nrf2 and (C) Keap1 (70 kDa) protein expression was examined by immunoblotting. Black bars, full-length (FL) Nrf2 (56 kDa); gray bars, degraded (Deg) Nrf2 (40 kDa); white bars, total (Tot) Nrf2; the sums of full-length Nrf2 and degraded Nrf2 were determined to obtain relative total Nrf2 protein expression. (B) Relative steady-state Nrf2 and (D) Keap1 mRNA levels were measured by SYBRGreen qPCR and normalized to 18S rRNA. Significance was determined by one-way ANOVA Dunnett’s for protein and one-way ANOVA Bonferroni’s for mRNA; * Pr0.05 as compared to Day 0, bars indicate Pr0.05 between samples. Data are expressed as mean7SD; n¼3–4.

Article Snippet: We also tried the Santa Cruz N-terminal Nrf2 antibody (No. sc-13032) that gave 6–7 signals ranging from 30 to 100 kDa and another C-terminal Nrf2 antibody from R & D Systems (No. MAB3925) that gave 20þ signals ranging from 20 to 100þ kDa (data not shown).

Techniques: Expressing, Western Blot

Journal: Free radical biology & medicine

Article Title: NAD(P)H:quinone oxidoreductase 1 activity reduces hypertrophy in 3T3-L1 adipocytes.

doi: 10.1016/j.freeradbiomed.2012.05.047

Figure Lengend Snippet: Fig. 3. NQO1 protein increases during limited clonal expansion and postmitotic growth arrest of differentiation. 3T3-L1 cells were differentiated as described under Materials and methods and harvested on Days 0, 1, 2, 3, and 4. (A) NQO1 and (D) Keap1 protein expressions were examined by immunoblotting. (B) Relative NQO1, (C) Nrf2, and (E) Keap1 mRNA levels were measured by SYBRGreen qPCR and normalized to 18S rRNA. Significance was determined by one-way ANOVA Dunnett’s for protein and one-way ANOVA Bonferroni’s for mRNA; * Pr0.05 as compared to Day 0, bars indicate Pr0.05 between samples. Data are expressed as mean7SD; n¼3–4.

Article Snippet: We also tried the Santa Cruz N-terminal Nrf2 antibody (No. sc-13032) that gave 6–7 signals ranging from 30 to 100 kDa and another C-terminal Nrf2 antibody from R & D Systems (No. MAB3925) that gave 20þ signals ranging from 20 to 100þ kDa (data not shown).

Techniques: Western Blot

Journal: Free radical biology & medicine

Article Title: NAD(P)H:quinone oxidoreductase 1 activity reduces hypertrophy in 3T3-L1 adipocytes.

doi: 10.1016/j.freeradbiomed.2012.05.047

Figure Lengend Snippet: Fig. 4. NQO1 and Keap1 proteins, but not mRNA, decreases as adipocyte differentiation progresses. 3T3-L1 cells were differentiated as described under Materials and methods and harvested on Days 4, 5, 6, 7, and 8. (A) NQO1 and (D) Keap1 protein expressions were examined by immunoblotting. (B) Relative NQO1, (C) Nrf2, and (E) Keap1 mRNA levels were measured by SYBRGreen qPCR and normalized to 18S rRNA. Significance was determined by one-way ANOVA Dunnett’s for protein and one-way ANOVA Bonferroni’s for mRNA; * Pr0.05 as compared to Day 4. Data are expressed as mean7SD; n¼3.

Article Snippet: We also tried the Santa Cruz N-terminal Nrf2 antibody (No. sc-13032) that gave 6–7 signals ranging from 30 to 100 kDa and another C-terminal Nrf2 antibody from R & D Systems (No. MAB3925) that gave 20þ signals ranging from 20 to 100þ kDa (data not shown).

Techniques: Western Blot

Journal: Free radical biology & medicine

Article Title: NAD(P)H:quinone oxidoreductase 1 activity reduces hypertrophy in 3T3-L1 adipocytes.

doi: 10.1016/j.freeradbiomed.2012.05.047

Figure Lengend Snippet: Fig. 6. LiCl treatment increases NQO1 protein, but not NQO1 mRNA. 3T3-L1 cells were differentiated as described under Materials and methods, and treated with varying concentrations of LiCl at Day 8 and harvested on Day 11. A 40 mM NaCl was used as a vehicle control (VC). (A) NQO1 was examined by immunoblotting. (B) Relative NQO1 and (C) Nrf2 mRNA levels were measured by SYBRGreen qPCR and normalized to 18S rRNA. Significance was determined by one-way ANOVA Dunnett’s; * Pr0.05 as compared to VC for protein and mRNA. Data are expressed as mean7SD; n¼3.

Article Snippet: We also tried the Santa Cruz N-terminal Nrf2 antibody (No. sc-13032) that gave 6–7 signals ranging from 30 to 100 kDa and another C-terminal Nrf2 antibody from R & D Systems (No. MAB3925) that gave 20þ signals ranging from 20 to 100þ kDa (data not shown).

Techniques: Control, Western Blot

Journal: Free radical biology & medicine

Article Title: NAD(P)H:quinone oxidoreductase 1 activity reduces hypertrophy in 3T3-L1 adipocytes.

doi: 10.1016/j.freeradbiomed.2012.05.047

Figure Lengend Snippet: Fig. 7. Sulforaphane increases NQO1 protein and mRNA levels. 3T3-L1 cells were differentiated as described under Materials and methods, and treated with varying concentrations of sulforaphane (SFN). A 0.3% DMSO was used as a VC. (A) NQO1 was examined by immunoblotting. (B) Relative NQO1 and (C) Nrf2 mRNA levels were measured by SYBRGreen qPCR and normalized to 18S rRNA. Significance was determined by one-way ANOVA Dunnett’s; * Pr0.05 as compared to VC for protein and mRNA. Data are expressed as mean7SD; n¼3.

Article Snippet: We also tried the Santa Cruz N-terminal Nrf2 antibody (No. sc-13032) that gave 6–7 signals ranging from 30 to 100 kDa and another C-terminal Nrf2 antibody from R & D Systems (No. MAB3925) that gave 20þ signals ranging from 20 to 100þ kDa (data not shown).

Techniques: Western Blot

Journal: iScience

Article Title: Inflammatory CD4 + T cells can waive NRF2-dependent SLC7A11-mediated cystine uptake by using ASCT1

doi: 10.1016/j.isci.2026.115680

Figure Lengend Snippet: Regulation of lipid peroxidation is extrinsically regulated by the SLC7A11 pathway in CD4 + T cells (A) Statistical analysis of SLC7A11 protein expression assessed by flow cytometry (shown as mean fluorescent intensity (MFI). CD4 + T cells were either left unstimulated (control) or measured at a distinct time point after stimulation with anti-CD3/CD28 antibodies. N = 3, 3 independently performed experiments, a one-way ANOVA multiple comparison test was performed. The calculated power of this experiment is 0.84. (B) ΔCT of SLC7A11 mRNA expression in human CD4 + T cells with and without anti-CD3/CD28 stimulation. N = 13, 4 independently performed experiments. (C) Gene expression in CD4 + T cells from WT and VAV cre Keap fl/fl (Keap1-KO) mice was assessed by microarray analysis. Colors indicate significant upregulation (red), or downregulation (green) compared to WT. (D) ΔCT of SLC7A11 mRNA expression in CD4 + T cells of WT and Keap1-KO mice, either left unstimulated or stimulated with anti-CD3/CD28 antibodies, 4 independently performed experiments. The calculated power of this experiment is 0.99 for the stimulated and unstimulated groups. (E) N-fold SLC7A11 expression in human CD4 T cells, either transfected with a control siRNA (Ctrl) or NRF2 siRNA. 3 independently performed experiments were performed. (F) N-fold SLC7A11 mRNA expression in human CD4 T cells treated with 4-OI or vehicle (Ctrl) N = 6, 4 independently performed experiments. A paired Student's t-test was performed comparing the groups of B–F. Data are presented as mean, error bars present ± SEM for all the presented graphs in this figure. Values were considered significant if ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001. N represents the number of biological replicates.

Article Snippet: To this, 10 nM NRF2 siRNA (OriGene, Germany; catalogue number SR321100) or a control was added, and transfection was performed according to the manufacturer’s instructions (Neon transfection, ThermoFisher Scientific; MPK10025).

Techniques: Expressing, Flow Cytometry, Control, Comparison, Gene Expression, Microarray, Transfection

Journal: iScience

Article Title: Inflammatory CD4 + T cells can waive NRF2-dependent SLC7A11-mediated cystine uptake by using ASCT1

doi: 10.1016/j.isci.2026.115680

Figure Lengend Snippet: SAS and erastin treatment reduce cystine uptake but not GSH content and cell viability in anti-CD3/CD28 stimulated CD4 + T cells (A) Flow cytometric analysis of cystine uptake measured by BioTracker Cystine-FITC in stimulated CD4 + T cells in the presence of SAS and erastin. Exemplary histogram, showing the cystine uptake after 0 min (blue) and after 30 min (red) of incubation, while the difference presented as ΔMFI was used to describe the cystine uptake. N = 4, 3 independently performed experiments. The calculated power of this experiment is 0.99. (B) Statistical analysis of cystine uptake (represented as MFI) of mouse WT and NRF2-KO CD4 + T cells with and without the addition of SAS and erastin. N = 6, 4 independently performed experiments. (C) Representative histograms of B showing the uptake after 0 min (blue) and 30 min (red), while the difference presented as ΔMFI was used to describe the cystine uptake. (D) Flow cytometric analysis of reactive oxygen species (ROS) (presented as MFI) of CD4 + T cells without and with the addition of SAS and erastin. Histograms of the measurements are shown on the right. The calculated power of this experiment is 0.986. (E) Flow cytometric analysis of intracellular GSH content (presented as ΔMFI) of CD4 + T cells with and without SAS and erastin. Histograms depict an overlay of the FMO (blue) and the GSH staining (red). GSH was determined by the GSH/GSSG Luminescence measurement of CD4 MACS HC PBMCs. The kit provides direct analysis of the supernatants' GSH and GSSG contents, which enables the calculation of the ratios. (F) Lipoperoxidation measurement using BODIPY 581/591 C11 (presented as MFI of the FITC signal) of CD4 + T cells without and with inhibition by SAS and erastin. Histograms of the two signals, i.e., PE and FITC, from BODIPY are shown on the right. The calculated power of this experiment is 0.94. (G) Flow cytometric analysis of Mitotracker (represented as MFI, mitochondrial mass) of CD4 + T cells and TMRM (represented by MFI, mitochondrial membrane potential) of Mitotracker positive cells is shown without and with the addition of SAS and erastin. The calculated power of this experiment is 0.99 for the mitochondrial mass and 1 for the mitochondrial membrane potential. (H) Fluorescent live/dead staining was evaluated by flow cytometry using the combinatory staining of Annexin V and fixable viability dye (FVD) without and with the addition of SAS and erastin. N = 3, 3 independent experiments were performed for the graphs (D) to (G). The statistical evaluation of all the represented graphs was performed using one-way ANOVA multiple comparison. (Data are presented as mean, error bars present ± SEM for all the presented graphs in this figure. Values were considered significant if ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001. N represents the number of biological replicates.

Article Snippet: To this, 10 nM NRF2 siRNA (OriGene, Germany; catalogue number SR321100) or a control was added, and transfection was performed according to the manufacturer’s instructions (Neon transfection, ThermoFisher Scientific; MPK10025).

Techniques: Incubation, Staining, Inhibition, Membrane, Flow Cytometry, Comparison

Journal: iScience

Article Title: Inflammatory CD4 + T cells can waive NRF2-dependent SLC7A11-mediated cystine uptake by using ASCT1

doi: 10.1016/j.isci.2026.115680

Figure Lengend Snippet: Characterization of an altered NRF2/cystine pathway in patients with JIA (A) Flow cytometric analysis of SLC7A11 expression in stimulated SF and PB CD4 + T cells. Statistical analysis was performed with N = 7 donors, 7 independently performed experiments. (B) Flow cytometric evaluation of cystine uptake (shown as MFI) by anti-CD3/CD28 stimulated CD4 + SF T cells. N = 6, 6 independently performed experiments. (C) Flow cytometric analysis of intracellular glutathione content (presented as ΔMFI) of stimulated SF and PB CD4 + T cells. N = 9, 9 independently performed experiments. (D) Statistical analysis of MFI of ROS in stimulated SF and PB CD4 + T cells ( N = 4), 4 independently performed experiments. The calculated power of this experiment is 0.85. (E) Lipid peroxidation as assessed by flow cytometric measurement of anti-CD3/CD28 stimulated CD4 + T cells derived from PBMCs and SFMCs. N = 11. (F) Gene set enrichment analysis (GSEA) was performed on differentially expressed genes from SF-derived CD4 + T cells of patients with active JIA compared to PBMC-derived CD4 + T cells from healthy controls. The enrichment plots shown represent driver ferroptosis-related gene sets from KEGG, WikiPathways, and FerrDb V2. ( N = 4). (G) Heat maps showing normalized counts of selected RNAs determined by RNA-seq in JIA CD4 + T cells compared to HC CD4 + T cells. N = 4 in each group. (H) SFMCs and PBMCs were analyzed for ASCT1 expression by quantitative RT-PCR. The calculated power of this experiment is 0.99. (I) Flow cytometric analysis of CD36 expression of stimulated SF and PB CD4 + T cells. N = 5, 5 independently performed experiments. (J) Representative histograms showing BODIPY Ferroptosis staining of anti-CD3/CD28 stimulated HC PBMCs in the absence and presence of ASCT1/2 inhibition by 4-Hydroxy-L-phenylglycin (HPG) and SAS. N = 3, 3 independent experiments. The statistical evaluation of (A), (C), (E), (H), and (I) from the represented graphs was performed using a paired Student’s t-test. One-way ANOVA multiple comparison was used for (B) and (D) of the represented graphs. Data are presented as mean, error bars present ± SEM for all the presented graphs in this figure. Values were considered significant if ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, and ∗∗∗∗ p < 0.0001. N represents the number of biological replicates.

Article Snippet: To this, 10 nM NRF2 siRNA (OriGene, Germany; catalogue number SR321100) or a control was added, and transfection was performed according to the manufacturer’s instructions (Neon transfection, ThermoFisher Scientific; MPK10025).

Techniques: Expressing, Derivative Assay, RNA Sequencing, Quantitative RT-PCR, Staining, Inhibition, Comparison

Journal: Oncogene

Article Title: NRF2 activation by cysteine as a survival mechanism for triple-negative breast cancer cells.

doi: 10.1038/s41388-024-03025-0

Figure Lengend Snippet: Fig. 2 Transcriptome analysis of Hs 578T cells deprived of Cyss from culture medium reveals NRF2 pathway downregulation. A Hs 578T cells transduced for the expression of GFP were cultured in complete or Cyss-free medium for 8 h, and gene expression was analyzed by RNA-seq. The transduction with GFP was carried out in anticipation of later experiments with exogenous protein expression. Adjusted p value (p adj) < 0.1 and |log2 fold change| (log2FC) > 0.32 fold change were used as thresholds for analysis. A gene was considered expressed if there were at least 10 DESeq2 mean normalized counts in either the complete or Cyss-free growth condition. B Volcano plot showing the differentially expressed genes (DEGs) after Cyss depletion. Genes down-regulated are shown in red, genes up-regulated are shown in blue. Top ten upregulated and downregulated DEGs are reported. C Dot plot showing significantly activated and suppressed Wikipathways (permutation test’s BH p-adj<0.05) resulting from gene set enrichment analysis (GSEA). Dot radii indicate the number of genes annotated with corresponding terms (Count). GeneRatio stands for the relative proportion of involved genes of each pathway (i.e. Count/setSize). D Cnetplot plot showing fold changes in expression of genes associated with the “NRF2 pathway” and the closely related “metapathway biotransformation phase I and II”. E RT-qPCR analysis of mRNA levels for four known NRF2 transcriptional targets (GCLM, GSR, NQO1, MGST1) in the indicated cell lines. mRNA levels are normalized to β-actin (ACTB) mRNA levels. Data represent the mean ± SD of independent experiments (N = 3) and are expressed as fold change over control with Cyss in the medium. *p ≤0.05; **p ≤0.01; ***p ≤0.001; ****p ≤0.0001. ± Cyss conditions were compared using the two-tailed unpaired t-test. An F test was used to compare variance.

Article Snippet: Lentiviral plasmid for KEAP1 expression (#RC202189L3) and NRF2 (#RC204140L1) were purchased from ORIGENE (Rockville, MD, USA).

Techniques: Expressing, Cell Culture, Gene Expression, RNA Sequencing, Transduction, Quantitative RT-PCR, Control, Two Tailed Test

Journal: Oncogene

Article Title: NRF2 activation by cysteine as a survival mechanism for triple-negative breast cancer cells.

doi: 10.1038/s41388-024-03025-0

Figure Lengend Snippet: Fig. 3 Free Cyss induce NRF2 expression and activity in TNBC cell lines of the mesenchymal stem-like subtype. A Western blot analysis of TNBC and non-TNBC cell lines cultured for 16 h in presence or absence of Cyss. TNBC cell lines are assigned to the molecular subtypes according to Lehmann et al. [4]: mesenchymal (M), Mesenchymal stem-like (MSL), basal-like 1 (BL1), Immunomodulatory (IM), luminal androgen receptor (LAR), and unclassified (Uncl.). Analysis of total ERK1/2 expression was used as loading control. B Analysis of the band intensity of NRF2. NRF2 levels in cells growing in presence of Cyss are normalized to the ERK1/2 levels, refer to NRF2 expression in Hs 578T cells, and are plotted on the x-axis. On the y-axis, the normalized NRF2 levels obtained in the absence of Cyss are shown for each cell line individually as a fold change compared to the controls with Cyss. Data are expressed as mean values ± SD. C, D Analysis of NRF2 activity by transient transfection of the indicated breast cancer (BRCA) cells with ARE-luc2P reporter plasmid (pGL4.37[ARE-luc]). The Firefly luciferase values were normalized to Renilla luciferase activity (pRL-SV40 vector). Data represent the mean ± SD (N = 3) and are expressed as fold change compared to cells grown in presence of Cyss. ± Cyss conditions were compared using the two-tailed unpaired t-test. An F test was used to compare variance. E Bright-field images of Hs 578 T cells transduced for the expression of NRF2-ΔN89 or GFP as control and treated for 24 h as indicated. Scale Bar = 100 µm. F Viability assay of the indicated cell lines transduced as in (B) and grown in presence or absence of Cyss for 24 h. Two-way ANOVA was followed by Tukey’s multiple comparisons test. G Boxplot showing CUL3, KEAP1 and NFE2L2 gene expression distributions among TNBC METABRIC samples grouped by Lehmann subtypes. Significance of Kruskal-Wallis test on median is reported (** for p < 0.001). H The frequency of samples with altered KEAP1, CUL3 and NFE2L2 genes in 27 datasets of TCGA collection is shown. The alterations include single nucleotide variants, gene deletion and gene amplification. BRCA: breast cancer. I For samples belonging to TCGA BRCA cohort, the number of samples with altered KEAP1, CUL3 or NFE2L2 is reported, distinguishing between TNBC and non-TNBC. *p ≤0.05; **p ≤0.01; ****p ≤0.0001.

Article Snippet: Lentiviral plasmid for KEAP1 expression (#RC202189L3) and NRF2 (#RC204140L1) were purchased from ORIGENE (Rockville, MD, USA).

Techniques: Expressing, Activity Assay, Western Blot, Cell Culture, Control, Transfection, Plasmid Preparation, Luciferase, Two Tailed Test, Viability Assay, Gene Expression

Journal: Oncogene

Article Title: NRF2 activation by cysteine as a survival mechanism for triple-negative breast cancer cells.

doi: 10.1038/s41388-024-03025-0

Figure Lengend Snippet: Fig. 4 Cyss uptake by SLC7A11/xCT induce the expression and activation of NRF2. A Quantitative analysis of cytoplasmic Cys content after 8 h of treatment with Erastin (N = 3). B Western blot analysis for NRF2 expression in the indicated cell lines treated for 8 h as indicated. C Quantification of western blot analyses as in (B). Data represent the average ± SD of independent experiments and are expressed as fold change compared to cells grown in absence of Erastin (N = 3). D Analysis of the NRF2 activity by transient transfection of the indicated cells with ARE-luc2P reporter plasmid. Cells were treated as indicated for 8 h. Data represent the mean ± SD (N = 4) and are expressed as fold change compared to cells grown in absence of Erastin. *p ≤0.05; **p ≤0.01; ***p ≤0.001; ****p ≤0.0001. One-way (C, D) and two-way (A) ANOVA were followed by Sidak’s (A), Tukey’s (C), or Dunnett’s (D) multiple comparisons test.

Article Snippet: Lentiviral plasmid for KEAP1 expression (#RC202189L3) and NRF2 (#RC204140L1) were purchased from ORIGENE (Rockville, MD, USA).

Techniques: Expressing, Activation Assay, Western Blot, Activity Assay, Transfection, Plasmid Preparation

Journal: Oncogene

Article Title: NRF2 activation by cysteine as a survival mechanism for triple-negative breast cancer cells.

doi: 10.1038/s41388-024-03025-0

Figure Lengend Snippet: Fig. 6 NRF2 target genes downstream of its Cys-dependent activation. A Western blot analysis of NRF2 expression in Hs 578T cells transduced with lentiviral vectors for the expression of NRF2-FL (NRF2) or GFP (as control). Whole protein extracts were prepared after 8 h of growth in presence (w Cyss) or absence (w/o Cyss) of Cyss. The same cells as in (A) were processed for RNA-seq analysis. B DESeq2 mean of normalized counts for NRF2 gene (NFE2L2). Two-way ANOVA was followed by Sidak’s multiple comparisons test. C Euler diagram showing effect of the expression of exogenous NRF2 on DEGs upregulated in GFP control cells by Cyss depletion. D Euler diagram showing the effect of exogenous NRF2 expression on downregulated DEGs in GFP control cells by Cyss depletion. Adjusted p value (p adj) <0.1 and |log2FC| > 0.32 were used as thresholds for analysis. E Hierarchical clustering of selected DEGs in control cells following Cyss (GFP w/o Cyss vs GFP w Cyss, |log2FC| > 0.32, p-adj > 0.1), considering their expression fold change relative to all the compared conditions. Color scale refers to the fold change values of DE transcripts. F, G DESeq2 mean normalized counts for one gene from each subgroup of NRF2-modulated genes as example. The corresponding pie chart segments are drawn.

Article Snippet: Lentiviral plasmid for KEAP1 expression (#RC202189L3) and NRF2 (#RC204140L1) were purchased from ORIGENE (Rockville, MD, USA).

Techniques: Activation Assay, Western Blot, Expressing, Transduction, Control, RNA Sequencing

Journal: Oncogene

Article Title: NRF2 activation by cysteine as a survival mechanism for triple-negative breast cancer cells.

doi: 10.1038/s41388-024-03025-0

Figure Lengend Snippet: Fig. 7 The prognostic values of upregulated genes downstream of NRF2 activation by Cyss in TNBC and non-TNBC. A The Kaplan-Meier plotter database was used to analyzed RFS and DMFS for TNBC and non-TNBC patients with high or low expression of the indicated genes. Bubble plot reports -log10 of the p values (-logP), the hazard ratio (HR) of RFS and the number of patients for each analysis. B, C Forest plot reporting the HRs and the 95% confidential intervals of RFS (B) and DMFS (C) for 21 genes downregulated by Cyss depletion and upregulated by NRF2 (RP11-443P15.2 was not reported because absent in the database). D Kaplan-Meier plots of the indicated genes for TNBC patients.

Article Snippet: Lentiviral plasmid for KEAP1 expression (#RC202189L3) and NRF2 (#RC204140L1) were purchased from ORIGENE (Rockville, MD, USA).

Techniques: Activation Assay, Expressing

Journal: British journal of cancer

Article Title: Retinoic acid synergizes ATO-mediated cytotoxicity by precluding Nrf2 activity in AML cells.

doi: 10.1038/bjc.2014.380

Figure Lengend Snippet: Figure 1. ATO induced Nrf2 targets in AML cells. (A) HL60 and THP-1 nuclear (N) or total (T) protein levels of Nrf2, TBP1, HO-1, NQO1 and b- actin. Cells were incubated for 24 h with 6.25 mM ATO. (B) Reverse-transcription PCR (upper panels) analysis of GAPDH, HO-1, NQO1, GCLM and ferritin targets mRNA levels and nuclear Nrf2 translocation (bottom panels) in HL60 and THP-1 cells following ATO (6.25 mM) or t-BHQ (25 mM) treatments for 24 h. (C) HL60 cells were electroporated either with the pRS-control or pRS-shNrf2 plasmids and treated with ATO (6.25 mM) for 12 h. Total protein extracts were analysed for the presence of Nrf2, NQO1, HO-1 and b-actin by immunoblotting. (D) HL60 and THP-1 cells were treated with different concentrations of ATO, Ara-C or daunorubicin for 24 h, as indicated. Following treatment, total protein extracts were prepared and NQO1, HO-1 and b-actin protein levels were evaluated by immunoblotting. A typical western blot out of three experiments is shown. (E) GSH content was determined in HL60 and THP-1 cells treated with ATO (6.25 mM), Ara-C (5 mM), daunorubicin (0.5 mM) or t-BHQ (25 mM) for 24 h. Statistically significant differences with respect to the control condition are indicated (means±s.e.m.; n ¼ 3; *Pp0.05, **Pp0.01, ***Pp0.001). Ctl, control.

Article Snippet: The short hairpin RNA (shRNA) expression vector was obtained by cloning a shRNA cassette directed against human Nrf2 mRNA (shRNA duplex sense 50-GATCCGTAAGAAGCCAGATGTTAAGTCAAGAGCTTAACA TCTGGCTTCTTACTTTTTTTTGGAA-30 and antisense 50-AGC TTTCCAAAAAAAAGTAAGAAGCCAGATGTTAAGCTCTTGA CTTAACATCTGGCTTCTTACG-30) in the BamHI/HindIII cloning sites of the pRS vector (TR2003, Origene, Rockville, MA, USA).

Techniques: Incubation, Reverse Transcription, Translocation Assay, Control, Western Blot

Journal: British journal of cancer

Article Title: Retinoic acid synergizes ATO-mediated cytotoxicity by precluding Nrf2 activity in AML cells.

doi: 10.1038/bjc.2014.380

Figure Lengend Snippet: Figure 2. Pharmacologic inhibition of Nrf2 targets (HO-1 and GSH) sensitises AML and APL cells to ATO. (A) Cell viability was determined in HL60, THP-1 and NB4 cells exposed for 48 h to different concentrations of ATO (0–25 mM) in the presence (triangles) or absence (squares) of ZnPP (5 mM) using the trypan blue exclusion assay. (B) HL60 cells treated with ATO (6.25 mM) in the presence of ZnPP (5 mM) for 24 h. Cell extracts were prepared and DEVDase activity was assessed as described in the Materials and Methods section. The pan-caspase inhibitor 10 mM Q-VD-OPh (QVD) was included as a negative control (data not shown). (C–D) HL60 and NB4 cells were pre-incubated in the presence or the absence of BSO (10 mM) for 24 h ( þ BSO) and then treated with ATO (6.25 and 0.75 mM, respectively) for an additional 12 h. Cytotoxicity was determined either by (C) trypan blue exclusion assay or (D) DEVDase activity. Statistically significant differences with respect to the control condition are indicated (means±s.e.m.; n ¼ 3; *Pp0.05, **Pp0.01, ***Pp0.001).

Article Snippet: The short hairpin RNA (shRNA) expression vector was obtained by cloning a shRNA cassette directed against human Nrf2 mRNA (shRNA duplex sense 50-GATCCGTAAGAAGCCAGATGTTAAGTCAAGAGCTTAACA TCTGGCTTCTTACTTTTTTTTGGAA-30 and antisense 50-AGC TTTCCAAAAAAAAGTAAGAAGCCAGATGTTAAGCTCTTGA CTTAACATCTGGCTTCTTACG-30) in the BamHI/HindIII cloning sites of the pRS vector (TR2003, Origene, Rockville, MA, USA).

Techniques: Inhibition, Trypan Blue Exclusion Assay, Activity Assay, Negative Control, Incubation, Control

Journal: British journal of cancer

Article Title: Retinoic acid synergizes ATO-mediated cytotoxicity by precluding Nrf2 activity in AML cells.

doi: 10.1038/bjc.2014.380

Figure Lengend Snippet: Figure 3. The association of ATRA and ATO inhibited Nrf2 nuclear translocation promoting cell death in both AML and APL cells. HL60 and NB4 cells were pretreated with ATRA (1 mM) for 2 h and then exposed to ATO (3.1–6.25 mM; 12 h and 0.75–1.5 mM; 24 h), respectively. (A) After treatment, total and nuclear protein extracts were prepared and HO-1, NQO1, Nrf2 and b-actin protein levels were assessed by immunoblotting. Illustrations of typical western blots are shown. (B) GSH content in both HL60 and NB4 cells, under the same conditions described above, was determined as described in the Materials and Methods section. Cytotoxicity was assessed by using (C) trypan exclusion assay and (D) DEVDase activity. HL60 and NB4 cells were exposed to ATO (6.25 and 0.75mM) for 24 or 48h, respectively. Statistically significant differences with respect to the control condition are indicated (means±s.e.m.; n ¼ 3; *Pp0.05, **Pp0.01, ***Pp0.001). Ctl, control.

Article Snippet: The short hairpin RNA (shRNA) expression vector was obtained by cloning a shRNA cassette directed against human Nrf2 mRNA (shRNA duplex sense 50-GATCCGTAAGAAGCCAGATGTTAAGTCAAGAGCTTAACA TCTGGCTTCTTACTTTTTTTTGGAA-30 and antisense 50-AGC TTTCCAAAAAAAAGTAAGAAGCCAGATGTTAAGCTCTTGA CTTAACATCTGGCTTCTTACG-30) in the BamHI/HindIII cloning sites of the pRS vector (TR2003, Origene, Rockville, MA, USA).

Techniques: Translocation Assay, Western Blot, Exclusion Assay, Activity Assay, Control

Journal: British journal of cancer

Article Title: Retinoic acid synergizes ATO-mediated cytotoxicity by precluding Nrf2 activity in AML cells.

doi: 10.1038/bjc.2014.380

Figure Lengend Snippet: Figure 5. Loss of ATRA-mediated Nrf2 inhibitory mechanism in the NB4-R2 retinoic acid-resistant cell line. (A) HL60, NB4 and NB4-R2 cells were treated for 3 days with ATRA 1 mM. Differentiation was determined by the NTB reduction assay as indicated in Materials and Methods. (B) NB4-R2 and NB4 cells were treated with ATO (0.75 mM) in the presence of ATRA (1 mM) for 24 h. After treatment, total protein extracts were prepared and HO-1 and b-actin protein levels were assessed by immunoblotting. Illustration of a typical western blot is shown. (C) GSH content was measured in NB4-R2 cells treated with ATO (0.75 mM) in the presence of ATRA (1 mM) for 24 h. Cell survival was assessed in NB4-R2 cells treated with ATO (0.75 mM) in the presence of ATRA (1 mM) for 24 h using (D) DEVDase activity or (E) the trypan blue exclusion assays. (F) NB4 cells were incubated with Ro-41-5351 (0.5 mM) for 24 h and then treated with ATRA (1 mM) and ATO (0.75 mM) for additional 24 h. Cell extracts were collected and cell survival was assessed by using the trypan blue exclusion assay. Statistically significant differences with respect to the control condition are indicated (means±s.e.m.; n ¼ 3; *Pp0.05, **Pp0.01, ***Pp0.001). Ctl, control.

Article Snippet: The short hairpin RNA (shRNA) expression vector was obtained by cloning a shRNA cassette directed against human Nrf2 mRNA (shRNA duplex sense 50-GATCCGTAAGAAGCCAGATGTTAAGTCAAGAGCTTAACA TCTGGCTTCTTACTTTTTTTTGGAA-30 and antisense 50-AGC TTTCCAAAAAAAAGTAAGAAGCCAGATGTTAAGCTCTTGA CTTAACATCTGGCTTCTTACG-30) in the BamHI/HindIII cloning sites of the pRS vector (TR2003, Origene, Rockville, MA, USA).

Techniques: Western Blot, Activity Assay, Incubation, Trypan Blue Exclusion Assay, Control

Journal: Nature Communications

Article Title: The PIK3CA/AKT pathway drives therapy resistance in rhabdomyosarcoma

doi: 10.1038/s41467-025-66632-9

Figure Lengend Snippet: A Histopathology of xenografted tumors. Representative RD parental sensitive (S1) and resistant models (R1, R4) showing co-immunofluorescence staining of PI3Kα (Alexa Fluor 546) and MDR1 (Alexa Fluor 488); IHC for p-AKT (Ser473) and p-NRF2 (Ser40; A , left). Quantification of percent positive cells within each model mean +/− ST noted on images or in graphical analysis (right). N = 3 in sensitive models and n = 6 in resistant models (biological replicates, RD and Rh41). Data are mean ± SD. B Western blot analysis of RD and Rh41 cell line grown after selection in xenografted mice. Data shown are from one representative experiment and was repeated three times using biological replicates with similar results. The lysates derive from the same experiment but were run on different gels. One gel was used for analysis of PI3K p110, Nrf2, p-Nrf2, AKT, p-AKT, p-4EBP1, S6, another for EGFR, PI3K p85, p-PI3K p85, MDR1, MRP1, BCRP, p-PTEN, PTEN, 4EBP1, and p-S6. Both gels were processed in parallel. C Quantification of cell viability following drug treatment in RD and Rh41 models. Cells treated for 4 days. Grey denotes comparisons that were not done. Scale (1.0 growth/viable and 0.0 dead). Data shown as mean from three independent biological replicates. D Representative confocal image of RD therapy sensitive and resistant model following treatment with PARPi-FL (red) and temozolomide (TMZ) or in combination with alpelisib PIK3CAα inhibitor (OT + AL) or Tariquidar ABC transport inhibitor (OT + TA). Samples were counterstained with NucBlue. Z-stack image (top, D ) and cell cross-section (bottom, D ). E Quantification of relative PARPi-FL uptake in therapy sensitive and OT resistant RD and Rh41 cells subjected to OT, OT + alpelisib (AL), OT + tariquidar (TA). n > 248 cells per condition. Shown is a representative example from one of three independent, biological replicate experiments; similar results observed across all experiments ( D , E ). F Representative images and G flow cytometry analysis of RD parental sensitive (S1) and resistant cells (R1, R4) showing fluorescence eFluxx-ID® signals after treating with DMSO or alpelisib PIK3CAα inhibitor (AL). The fluorescence signal of the dye negatively correlates with the activity of the ABC transporters. Images are representative of three independent biological replicates ( F , G ). P < 0.05 was considered statistically significant. ANOVA followed by Dunnett post hoc test was used to make comparisons between sensitive and resistant clones ( A ). ANOVA followed by two-sided Student’s T -test comparisons within each resistant model ( E ). Scale bar equals 25 µm ( A ), 10 µm ( D , upper; F ), and 2 µm ( D , lower).

Article Snippet: NRF2 recombinant protein from OriGene (TP760529), the Electrophoretic Mobility-Shift Assay (EMSA) Kit from Invitrogen (E33075) were used to detect the DNA shift after protein binding.

Techniques: Histopathology, Immunofluorescence, Staining, Western Blot, Selection, Flow Cytometry, Fluorescence, Activity Assay, Clone Assay

Journal: Nature Communications

Article Title: The PIK3CA/AKT pathway drives therapy resistance in rhabdomyosarcoma

doi: 10.1038/s41467-025-66632-9

Figure Lengend Snippet: RD ( A – D ) and Rh41 cells ( E – H ). A , E Western blot showing pathway activation in cells that lentivirally express activated PIK3CA (H1047R), myristoylated AKT1 (Myr-AKT1), or WT is empty vector. Shown are representative examples from one of three independent, biological replicate experiments. The lysates derive from the same experiment but were processed in parallel and run on different gels. For ( A ), one gel analyzed MDR1, Nrf2, and another analyzed PI3K p110, PI3K p85, MRP1, BCRP, P-Nrf2, AKT, P-AKT. While in ( E ), one gel analyzed MRP1, BCRP, a second analyzed PI3K p110, PI3K p85, Nrf2, P-Nrf2, AKT, P-AKT, and the third analyzed MDR1 ( E ). B , F qRT-PCR quantitation of ABC transporters. Normalized to GAPDH. Representative data showing mean ± SD from five technical replicates. Similar results were obtained from analysis of three biological replicates. C , G CellTiter-Glo analysis showing relative growth of cells after 5 days of treatment with DMSO or OT. P values denote differences in control cells before and after OT treatment. Data are mean ± SD from n = 3 biological replicates. D , H Quantification of drug uptake after 4 days of treatment of PARPi-FL with temozolomide. Number of cells per treatment group noted on the image. Shown is a representative example from one of three independent, biological replicate experiments; similar results observed across all experiments ( D – H ). Two-sided Student’s T -test was used to compare cell killing by DMSO control or OT treatment within each model ( C and G ). P < 0.05 was considered statistically significant.

Article Snippet: NRF2 recombinant protein from OriGene (TP760529), the Electrophoretic Mobility-Shift Assay (EMSA) Kit from Invitrogen (E33075) were used to detect the DNA shift after protein binding.

Techniques: Western Blot, Activation Assay, Plasmid Preparation, Quantitative RT-PCR, Quantitation Assay, Control

Journal: Nature Communications

Article Title: The PIK3CA/AKT pathway drives therapy resistance in rhabdomyosarcoma

doi: 10.1038/s41467-025-66632-9

Figure Lengend Snippet: A–D siRNA knockdown of NRF2 results in reduced ABC transporter expression and function in resistant models. A Western blot analysis following 4 days of siRNA knockdown. Shown are representative examples from one of three independent, biological replicate experiments. The lysates derive from the same experiment but were processed in parallel and run on different gels. One gel analyzed MDR1, MRP1, BCRP, Nrf2, p-Nrf2, and a second analyzed S6, p-S6. B qRT-PCR showing that ABC transporters are transcriptionally upregulated in resistant clones and can be downregulated following siNRF2. P values in black denote comparison to RD-S control siRNA cells and red denotes comparison within each resistant model. Representative analysis showing mean ± SD from four technical replicates. Similar results were obtained from three independent experiments that used additional biological replicates. C Quantification of PARPi-FL within individual resistant models after 4 days of siRNA knock-down. n ≥ 153 cells per condition. Shown is a representative example from one of three independent, biological replicate experiments; similar results observed across all experiments ( C ). D CellTiter-Glo analysis showing relative growth of cells after 7 days of DMSO or OT drug treatment in siControl or siNRF2 knockdown cells. P values denote differences in siControl and siNRF2 in each drug treatment group. Data are mean ± SD from n = 3 biological replicates. E , F Alpelisib PIK3Cα inhibitor reduces ABC transporter expression. Western blot ( E , representative example, completed three times using independent biological replicates) or qRT-PCR analysis ( F , samples normalized to GAPDH) following 4 days of alpelisib treatment. qRT-PCR analysis shows mean ± SD from four technical replicates. Similar results were obtained from three independent experiments that used additional biological replicates. Shown in ( E ) are representative examples from one of three independent, biological replicate experiments. The lysates derive from the same experiment but were processed in parallel and run on different gels. One gel analyzed PI3K p110, PI3K p85, MDR1, MRP1, Nrf2, P-Nrf2, AKT, P-AKT, and a second analyzed BCRP ( E ). G ChIP-qPCR analysis of NRF2 occupancy on the ABCB1 (MDR1), ABCC1 (MRP1), and ABCG2(BCRP) promoters/enhancers following treatment with vehicle or alpelisib for 4 days. Data shows mean ± SD from four technical replicates. Similar results were obtained from two independent experiments that used additional biological replicates. P < 0.05 was considered statistically significant. Two-sided Student’s T -test was used in ( C , D ).

Article Snippet: NRF2 recombinant protein from OriGene (TP760529), the Electrophoretic Mobility-Shift Assay (EMSA) Kit from Invitrogen (E33075) were used to detect the DNA shift after protein binding.

Techniques: Knockdown, Expressing, Western Blot, Quantitative RT-PCR, Clone Assay, Comparison, Control, ChIP-qPCR

Journal: Nature Communications

Article Title: The PIK3CA/AKT pathway drives therapy resistance in rhabdomyosarcoma

doi: 10.1038/s41467-025-66632-9

Figure Lengend Snippet: A Quantification of PDX tumor growth in individual mice ( A , left, Fisher exact test) and juxtaposed to Kaplan–Meier survival analysis (right). N = 6 mice per arm. Log-rank (Mantel–Cox) test was used to compare the significance between vehicle control and OT + AL treated mice. Resistant models FN-MAST139 (R1, top) and FN-MAST39 PDX (R1, bottom). NSG mice administered 5 consecutive days of either vehicle control, OT, alpelisib (AL) or OT + AL (three dosing periods denoted by arrows). B Representative images of whole mouse or extracted tumor. C Body weight after tumor extraction. D Tumor weight at time of mouse sacrifice. Quantification used ANOVA followed by two-sided Student’s T -test. All data are presented with center value being the mean ± SD ( C , D ). E Histopathology of representative MAST139-R1 tumor. Hematoxylin and eosin staining (H&E), IHC for Ki67, TUNEL, IF staining of PI3Kα (Alexa Fluor 546) and MDR1 (Alexa Fluor 488), p-AKT (Ser473), and p-NRF2 (Ser40, left to right). Quantification denotes the mean percent positive area +/− STD across three animals (three image planes quantified per animal, n = 3 biological replicates), P < 0.05 was considered statistically significant. Scale bars equal 1 cm ( B ) and 25 μM ( E ).

Article Snippet: NRF2 recombinant protein from OriGene (TP760529), the Electrophoretic Mobility-Shift Assay (EMSA) Kit from Invitrogen (E33075) were used to detect the DNA shift after protein binding.

Techniques: Control, Extraction, Histopathology, Staining, TUNEL Assay